ID: 925451571

View in Genome Browser
Species Human (GRCh38)
Location 2:3973651-3973673
Sequence CTGGATATACAAAGAGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 472
Summary {0: 1, 1: 1, 2: 12, 3: 57, 4: 401}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925451571_925451573 -3 Left 925451571 2:3973651-3973673 CCATTGTCTCTTTGTATATCCAG 0: 1
1: 1
2: 12
3: 57
4: 401
Right 925451573 2:3973671-3973693 CAGCCTCTCAGACCACATTCTGG 0: 1
1: 0
2: 0
3: 19
4: 173
925451571_925451576 18 Left 925451571 2:3973651-3973673 CCATTGTCTCTTTGTATATCCAG 0: 1
1: 1
2: 12
3: 57
4: 401
Right 925451576 2:3973692-3973714 GGCTCCAGCCCTTCCTGCTGTGG 0: 1
1: 0
2: 3
3: 53
4: 389
925451571_925451580 26 Left 925451571 2:3973651-3973673 CCATTGTCTCTTTGTATATCCAG 0: 1
1: 1
2: 12
3: 57
4: 401
Right 925451580 2:3973700-3973722 CCCTTCCTGCTGTGGGACCTTGG 0: 1
1: 1
2: 10
3: 121
4: 800
925451571_925451577 19 Left 925451571 2:3973651-3973673 CCATTGTCTCTTTGTATATCCAG 0: 1
1: 1
2: 12
3: 57
4: 401
Right 925451577 2:3973693-3973715 GCTCCAGCCCTTCCTGCTGTGGG 0: 1
1: 1
2: 8
3: 37
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925451571 Original CRISPR CTGGATATACAAAGAGACAA TGG (reversed) Intergenic
900879475 1:5370364-5370386 CTGAATATGCAAACAAACAATGG + Intergenic
901266834 1:7917337-7917359 CAGGATAGACAAATTGACAATGG + Exonic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
903375536 1:22863439-22863461 CTGGATTCACAAAGGGACAGGGG + Intronic
904197556 1:28797035-28797057 CTTGCTATGGAAAGAGACAAGGG + Intergenic
904310346 1:29625299-29625321 CTGGGTAAACATAGAGAGAAAGG - Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
904891089 1:33780146-33780168 CTGGAGATACAAAGAGTGGAAGG - Intronic
906172000 1:43734133-43734155 CTGAGTAAATAAAGAGACAAAGG - Intronic
906337819 1:44949404-44949426 CTGAATATACAAAGATAAAAGGG - Intronic
906817384 1:48893000-48893022 CTGCATATACACAGACAGAAAGG + Intronic
907265045 1:53253840-53253862 TTGGATATAGATAGAGACAGAGG - Intronic
907346658 1:53787346-53787368 CTGAATATAAAAAGAAATAAAGG + Intronic
908244285 1:62215393-62215415 CTCAATATACAAACATACAATGG - Intergenic
908965162 1:69752385-69752407 CTGGAAAGAGAAAGAGACAAAGG - Intronic
909101564 1:71355672-71355694 CTGGAGATACAAAAAGATAGAGG - Intergenic
910199711 1:84686679-84686701 CAAGAGATACAAAGAGACAGGGG + Intronic
910366757 1:86474174-86474196 ATGGATATGTAAGGAGACAACGG + Intronic
911050098 1:93663681-93663703 CTGGAGATTCAAAGACAGAAAGG - Intronic
912269011 1:108190558-108190580 CTAAATATACGAAGAGATAATGG - Intronic
913119990 1:115731091-115731113 CAGAATATTTAAAGAGACAAAGG - Intronic
916477244 1:165181982-165182004 CAGGATATATAAATAGACAAAGG + Intergenic
917078768 1:171235311-171235333 CTGAATATACAAAGGGCCACAGG - Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
917942917 1:179941144-179941166 ATGTATATACAAATAGACTATGG + Intergenic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
919126061 1:193395304-193395326 CTGAATATGGAAACAGACAATGG + Intergenic
920552240 1:206872294-206872316 CTGAATATACAAACAGACAGTGG + Intergenic
921330970 1:214035626-214035648 CTGCTGATACAAGGAGACAATGG - Intronic
921371820 1:214431474-214431496 CTGAACATACAAAGAGTGAATGG + Intronic
922137378 1:222843104-222843126 CTTGATATATAATGAGAGAATGG + Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
924049035 1:240061787-240061809 CAGAATAAACAAACAGACAATGG + Intronic
924102290 1:240617296-240617318 ATGGATACACACAGAAACAAAGG - Intergenic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
1063549456 10:7016100-7016122 TTGGATATAGAAAGAGATAAAGG - Intergenic
1065835546 10:29654911-29654933 CTGGATAGAAAAAAAGACAGGGG - Intronic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1067071230 10:43133729-43133751 CTGAACATGCAAACAGACAATGG - Intergenic
1068137927 10:52969225-52969247 TTGGATACACATAGACACAAAGG - Intergenic
1068675170 10:59763040-59763062 CTGAATATACAAACAGACAGTGG - Intergenic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1069324093 10:67209384-67209406 CTAGAAATACAAGGAGAAAATGG + Intronic
1069467200 10:68651848-68651870 CGAGTTATACAAAAAGACAAAGG + Exonic
1070389201 10:75953982-75954004 CTAGATATTCAAAGAGAGAGAGG + Intronic
1071352077 10:84756690-84756712 TTGAATATATAAATAGACAAGGG + Intergenic
1073522486 10:104146672-104146694 CTGGATATACATGCAAACAAGGG + Intronic
1073807485 10:107113970-107113992 CTGGTAATACAAAAATACAAAGG + Intronic
1074249415 10:111729686-111729708 CTGGATTTACAAAGACAGTAAGG + Intergenic
1074253099 10:111773260-111773282 TTAGATAAGCAAAGAGACAAGGG - Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075145542 10:119879849-119879871 CTGCATATACAAACAGACAATGG - Intronic
1075626631 10:123968705-123968727 CTGGAGCTGCAAAGAGACTAAGG - Intergenic
1080305667 11:30832121-30832143 CTAGATCTAAAAAGAGAAAATGG + Intronic
1080355877 11:31444993-31445015 TTGTATTTACAAAGAGACAGAGG - Intronic
1080845051 11:36019736-36019758 CTGGATACAGAAAGAAACAAAGG + Intronic
1081171190 11:39871706-39871728 CTGTAAATTCAAAGAGAGAAGGG + Intergenic
1081902424 11:46640316-46640338 CTGAATATACTAACAGACAGTGG - Intronic
1081985909 11:47304037-47304059 TTGGATTTCCAAAGAGAGAAGGG - Intronic
1082090044 11:48081610-48081632 TGGGATATAAAAAGAGAGAATGG + Intronic
1082641957 11:55672615-55672637 CTGGACATACACAAAGGCAATGG - Intergenic
1082881594 11:58043387-58043409 ATGAATAGACAAATAGACAAAGG - Intronic
1083546564 11:63553295-63553317 CGTGATATACACAGAGTCAAAGG + Intronic
1085306882 11:75491417-75491439 CAGGAAATATAAAGAGACCATGG - Intronic
1085315593 11:75543026-75543048 CAGGATATACAGAGAGTCAGGGG - Intergenic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1087608182 11:100402945-100402967 TTGAATATACAAATAGGCAATGG + Intergenic
1087973595 11:104516350-104516372 TGGGATATATAAAGAGAGAAGGG - Intergenic
1087991078 11:104745630-104745652 CTGAATTTACAAAGAGAGGAAGG - Intergenic
1090037716 11:123263282-123263304 CTGGCTATACTAACGGACAATGG - Intergenic
1091115616 11:133010011-133010033 CTGGATATGAAAAGGGACTAGGG - Intronic
1091176903 11:133567196-133567218 CTGGATATACAAAAAAAAATAGG + Intergenic
1091462163 12:651893-651915 ATGGAAAAGCAAAGAGACAAAGG + Intronic
1091541466 12:1466288-1466310 CTGGACATACAGAAAGACACTGG - Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1093911225 12:24749591-24749613 CTGGATGTACAAGAAGACACAGG + Intergenic
1094001946 12:25705196-25705218 CTGAATATTCAAACAGCCAATGG + Intergenic
1094268122 12:28581557-28581579 CTGGATTTGCAAAGATATAAAGG - Intergenic
1095535273 12:43238557-43238579 CTGAATACACAAACAGATAATGG - Intergenic
1095683508 12:45005649-45005671 CTAGATATGCAAAGAGTGAAGGG - Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1095806724 12:46327639-46327661 AGGGAGATACAAAGAGAAAAGGG - Intergenic
1095854263 12:46843245-46843267 TTGCATATAGAAAGAGACAATGG - Intergenic
1097008977 12:55939104-55939126 CTGGATATCCTAAGAGGCAGTGG + Intronic
1098024952 12:66191474-66191496 ATGAATACACAAAGGGACAATGG - Intronic
1098057204 12:66520619-66520641 CTGGATATACACACAGATAGTGG + Intronic
1100784071 12:98060655-98060677 CTGGGAAGACAAAGAAACAAGGG - Intergenic
1102947638 12:117003888-117003910 CCAGACATACAAAGAGACATTGG - Intronic
1103027574 12:117586211-117586233 GAGGATATACACAGAGACACAGG + Intronic
1103099501 12:118160359-118160381 CTGGGTAGAAAAAGTGACAAAGG + Intronic
1103262010 12:119595586-119595608 CTGGTTTTACAAAGAGACTGAGG - Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104227956 12:126855025-126855047 ATGGAAATCCAAAGAGACCAAGG + Intergenic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1104604184 12:130175935-130175957 ATGGATACCCAAAGAGAAAAGGG - Intergenic
1106105888 13:26733260-26733282 CTAAATATACAAGTAGACAATGG + Intergenic
1106359943 13:29021800-29021822 TTGAATAAACAAAGACACAAGGG + Intronic
1106864097 13:33944816-33944838 CTGGATATTCAAGGAAACAGTGG + Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106881627 13:34138279-34138301 CTGAATATACAAACTGACATTGG + Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108380908 13:49853260-49853282 CTGGATATAAAAATAGAGGATGG - Intergenic
1108550326 13:51537592-51537614 CAGCATATGCAAAGAAACAAAGG - Intergenic
1108598531 13:51970953-51970975 CTGGAAATCCAAATAGGCAATGG - Intronic
1108915027 13:55597926-55597948 CTCCAGATACAGAGAGACAATGG - Intergenic
1109438036 13:62332174-62332196 CTGGATACACAAAGGGACAGTGG - Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1110893735 13:80722939-80722961 CTGGAAATGCAAGGAGAAAATGG + Intergenic
1111148694 13:84219011-84219033 CTGGGTCAACAAAGAAACAATGG + Intergenic
1111382822 13:87480999-87481021 CTGGATATTGAAAGAAAAAATGG - Intergenic
1111693691 13:91595980-91596002 CTTGAACTACAAAGAGAAAAAGG - Intronic
1112586093 13:100720285-100720307 CTGAATATACACATAGACAGTGG + Intergenic
1112614806 13:100993050-100993072 CTAGATTTACAAAGAAAAAATGG + Intergenic
1113502623 13:110789063-110789085 AAGGTTATACGAAGAGACAAGGG - Intergenic
1113941506 13:114020644-114020666 CTGGAGATAAAATGAAACAATGG + Intronic
1114346344 14:21799246-21799268 CTGGATATTGAAAGATAAAATGG - Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115209228 14:30948430-30948452 CTGGGTATACAAACAACCAAAGG + Intronic
1115268747 14:31527963-31527985 CTGGACATACAAGGAGATAACGG - Intronic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1118879673 14:69815592-69815614 GAGGATATACAGAGAGCCAAAGG + Intergenic
1119134916 14:72208581-72208603 CTGGAGATACAAAGGGAAATAGG - Intronic
1119451603 14:74716636-74716658 GGGGATATACAAATACACAAGGG - Intronic
1120290071 14:82556929-82556951 CAGGATATACAAAAAGCCAATGG - Intergenic
1120777456 14:88453151-88453173 CTGGGTATCCAAAGAGAAACAGG - Intronic
1120829963 14:88989257-88989279 CTTGATATCCAGAGAGAGAAGGG + Intergenic
1122012619 14:98763674-98763696 ATGGATATAAAAATTGACAAAGG + Intergenic
1122926890 14:104907499-104907521 GTCGATATTCAAAGAGATAATGG + Intergenic
1202921255 14_KI270723v1_random:32005-32027 CTGGATCTGCAAAGGGACTAGGG + Intergenic
1124157857 15:27243698-27243720 ATGAATATGCAAATAGACAATGG - Intronic
1124160179 15:27260963-27260985 ATGGAAATACAAGGACACAATGG + Intronic
1124580274 15:30947302-30947324 TGGCAAATACAAAGAGACAATGG + Intronic
1125071849 15:35564264-35564286 GTGGATACACAAAGAGACCCTGG - Intergenic
1126214844 15:46143254-46143276 CTGGAAAAAGAAAGAAACAAAGG + Intergenic
1126363175 15:47867053-47867075 GTGTATATACAAAGATAAAAAGG + Intergenic
1127133497 15:55894455-55894477 CTGCAAATACCAAGAGACACCGG + Intronic
1129958082 15:79657577-79657599 CTGTATATACAAACAGACAATGG + Intergenic
1130794359 15:87193228-87193250 CTGGACCAGCAAAGAGACAAAGG - Intergenic
1131375705 15:91921225-91921247 TTGGATACACAGAGAGACCAGGG - Intronic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1133410031 16:5560529-5560551 CAGGAGATTCAAACAGACAAAGG - Intergenic
1133598541 16:7316834-7316856 CTGGAAAAACAAAGGGACCAGGG + Intronic
1133611777 16:7440424-7440446 GTGGACATACAAAGGGACATAGG - Intronic
1134295595 16:12942693-12942715 CTGGGTAAACAAAGTGAAAAGGG - Intronic
1135055240 16:19226617-19226639 ATGGAGTTACAAATAGACAAGGG + Intronic
1136547002 16:30960595-30960617 CTGGAAATACAGAGATAGAAAGG - Intronic
1136607465 16:31346087-31346109 CTGAATATACAAAGGGATAGTGG + Intergenic
1137382452 16:48011911-48011933 CTGGAAGTTCAAAGAAACAAAGG + Intergenic
1137804746 16:51294245-51294267 TAGGACATACAAAGAGACTAAGG - Intergenic
1139566703 16:67782066-67782088 CTGGAAAAGCAAAGAGAAAAAGG - Intronic
1140086023 16:71797876-71797898 CTGGATATACAAGGAGAGTGGGG + Intronic
1140630214 16:76843276-76843298 CTGGATATACAAACAAATTAAGG - Intergenic
1143127048 17:4648982-4649004 CTGACTATACAAAAGGACAATGG - Intergenic
1143429889 17:6873384-6873406 CATGAAATTCAAAGAGACAAAGG + Intergenic
1144060662 17:11581123-11581145 CTGAATATGCAAGCAGACAATGG + Intergenic
1144067330 17:11636360-11636382 CTGGATAAACCAATAAACAAAGG - Intronic
1144581655 17:16462656-16462678 CTGGAAAACCAGAGAGACAAAGG - Intronic
1149108496 17:52997566-52997588 CTGGGTATTCAAAGAGCCCAAGG - Intergenic
1149478219 17:56981439-56981461 CTGGAAATATAAAGAGACTCTGG - Intronic
1150769217 17:68027247-68027269 CTTGGTATACAAACATACAATGG + Intergenic
1150842464 17:68621713-68621735 CTGGATTTTCAAAGAGAGATTGG + Intergenic
1152012370 17:77726494-77726516 CTGGCTATGCAAAGAGGCAGTGG - Intergenic
1153455540 18:5278033-5278055 CTGGATCTAATAACAGACAAAGG + Intergenic
1153596603 18:6731740-6731762 CTGTATTTACAAAGAGCCAGAGG + Intronic
1154128275 18:11713618-11713640 CTGAATATATAAACAGGCAATGG - Intronic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155730865 18:29156528-29156550 CTAGAAATACAAAGACAAAAAGG + Intergenic
1156898296 18:42271764-42271786 CTGTATATACAGTGAGTCAAAGG - Intergenic
1157015255 18:43704406-43704428 TTGAATATACGAACAGACAATGG - Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157989535 18:52478109-52478131 CAGGATATACATATAGACCAGGG - Intronic
1158156014 18:54426249-54426271 CTAGATAAACAAATAGTCAAGGG - Intergenic
1158197542 18:54905600-54905622 CTGGATTCACAAATATACAATGG - Intronic
1158512468 18:58103120-58103142 CTACATAGACAAATAGACAAAGG - Intronic
1158721048 18:59925057-59925079 TTGGAGATATAAAGAGACACCGG + Intergenic
1158728830 18:60000935-60000957 CTGGATAAATAAGGAAACAAAGG - Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1159987417 18:74859781-74859803 CTGGAAATACAAAGATAAATAGG - Intronic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1163278150 19:16298767-16298789 CTGGAAATAGAAAGTGACAATGG + Intergenic
1164242205 19:23399529-23399551 CTGGATCTGCAAAGAAAAAAAGG + Intergenic
1164850589 19:31479965-31479987 CTGGAAATACCAAAAGATAAAGG - Intergenic
1165014632 19:32871586-32871608 CTGGATACACAATGAACCAATGG - Intergenic
1166974649 19:46598515-46598537 AAGGATATTCAAAGAAACAATGG - Intronic
1167284683 19:48592494-48592516 CTGGATGGACAGATAGACAAAGG + Intronic
1167640744 19:50679988-50680010 ATGGAGAGACAGAGAGACAATGG + Intronic
1167937868 19:52922495-52922517 CTGGATGTACAGAGAGATGAAGG - Intergenic
1167999453 19:53432848-53432870 CTGGATGTACAGAGAGATGAAGG + Intronic
925451571 2:3973651-3973673 CTGGATATACAAAGAGACAATGG - Intergenic
926514766 2:13829129-13829151 TTGGATATACAAGGACTCAATGG - Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
929092313 2:38231326-38231348 CTGGAGAGAGAAAGAGAAAAAGG - Intergenic
930296666 2:49562871-49562893 CTAGAAATAAAAAGGGACAATGG + Intergenic
932271024 2:70410050-70410072 CTGGATATATATACACACAAAGG + Intergenic
932303463 2:70685026-70685048 CTAGCTACATAAAGAGACAATGG + Intronic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
934945103 2:98535051-98535073 CTGGATCTCCAGAGAGAAAAAGG + Intronic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935330148 2:101971219-101971241 GTGGATATACAAAAAGACAATGG - Intergenic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
935913854 2:107927378-107927400 CTGGTCCTACAAAGAAACAAAGG - Intergenic
935948456 2:108307189-108307211 CTGGTTATCCAAAGAGAAAAGGG - Intronic
936560334 2:113532961-113532983 CTGGTTTTAAAAAGAGACAAGGG - Intergenic
937477784 2:122230247-122230269 CTGGAGGTCCACAGAGACAAAGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938058926 2:128237295-128237317 ATGAATATACAAACAGACAATGG + Intronic
938171070 2:129077162-129077184 CTGAATATACACATACACAATGG - Intergenic
938883924 2:135623977-135623999 CTGTCTATACAGAGAGACATGGG + Intronic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
941908164 2:170737049-170737071 CTGAATATACATACAGACAATGG + Intergenic
941953974 2:171185537-171185559 CAGCATATCCAAAGATACAAAGG - Intronic
943719758 2:191191433-191191455 CTAGATATACAAAAGGACAATGG - Intergenic
943956487 2:194198524-194198546 CTTGAGAGACAAAGAGATAATGG - Intergenic
943974466 2:194455243-194455265 CTGGCTAAACCAAGAGACAGAGG - Intergenic
944473461 2:200080264-200080286 CTTGATACACAAGGACACAAAGG - Intergenic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
945943603 2:215973267-215973289 CTGGACAAGCAAAGAGATAACGG + Intronic
946511626 2:220364022-220364044 CTGGATATACATACACACCATGG + Intergenic
946594057 2:221286396-221286418 TTGGACACACAAAGAGACACTGG - Intergenic
946635348 2:221719016-221719038 CTGCATATACAAGCAGACAATGG + Intergenic
946761043 2:222993306-222993328 AGGGGTATAAAAAGAGACAATGG + Intergenic
947241003 2:227994527-227994549 CTGGATATACCAAGAGTAGATGG + Intronic
947810962 2:233003696-233003718 CTGGAGAAACAAAGACGCAAAGG + Intronic
947849146 2:233270970-233270992 CTTAATTTACAAAGAAACAAAGG + Intronic
1168992517 20:2106641-2106663 GTGGATAGGCGAAGAGACAAAGG + Intronic
1169537875 20:6565404-6565426 CTGGGGTTACAAAGAGACAATGG - Intergenic
1170279505 20:14629803-14629825 CAGGAAATAAAAAGAGACCAGGG - Intronic
1170819410 20:19743658-19743680 CTGAATATATAAAGGGACAATGG + Intergenic
1173691103 20:44961780-44961802 TTGGATAAACAAAGATAAAAAGG - Intergenic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1174714049 20:52737837-52737859 CTAGATAAACAAACAGACAGAGG + Intergenic
1175008781 20:55713287-55713309 CTGGGTACACAAAGAGAAATAGG - Intergenic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1175683124 20:61005860-61005882 CTGGGGAGACAAAGAGACAAGGG + Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1177378471 21:20305363-20305385 CTAGATAAACAAATGGACAATGG - Intergenic
1177556094 21:22690543-22690565 GTGGATATAGAAACAGACAATGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1177849963 21:26334073-26334095 CTGGATATTCCAAGAGACTTAGG - Intergenic
1178215723 21:30595586-30595608 CTGGATTTAGAAATTGACAAAGG - Intergenic
1178343409 21:31805110-31805132 CTGGATAGAAAAAGAAACAAAGG - Intergenic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1179983726 21:44910013-44910035 CTTGAAGTACTAAGAGACAAAGG + Intronic
1183106453 22:35618542-35618564 ATGGATAGACAAAGAGATGATGG - Intronic
1183106468 22:35618658-35618680 CTGGATAGACAAAGAGATGATGG - Intronic
1183603745 22:38856057-38856079 TAGGATATACAAAGAGTCAAAGG - Intergenic
1184052827 22:42021248-42021270 CTGGCTGTACAAAGAGGCCATGG - Intronic
1184144310 22:42599882-42599904 CTGGAGAAACAAAGGGACCAAGG + Intronic
951437399 3:22680605-22680627 CAGGTTATACAGAGTGACAAGGG + Intergenic
951811358 3:26703752-26703774 CTGAATATACAAACGGACAGTGG - Intronic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953173658 3:40529883-40529905 CTGGATGGACAAAGGAACAAAGG - Intronic
954506486 3:51080799-51080821 CTGGATATAAAATAAAACAACGG + Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG + Intergenic
957387525 3:79516545-79516567 GTGTATAAACAAAGAGACTATGG - Intronic
957682189 3:83451275-83451297 CTGTATATGCAAATAAACAATGG + Intergenic
957955075 3:87176005-87176027 CTGGTTATACAGATAGAAAATGG - Intergenic
958068388 3:88575911-88575933 CAAGATTTACAAAGAGAGAAGGG + Intergenic
958599859 3:96282400-96282422 CTAAATCTACAAAGAGACTATGG - Intergenic
958706325 3:97661089-97661111 CTGGATTTACAAAAAGAGCAGGG - Intronic
959050650 3:101521677-101521699 CTGAATATATGAAGAGACAATGG - Intergenic
959403963 3:105938085-105938107 ATGGATATACAGAGACAAAATGG - Intergenic
959442009 3:106388605-106388627 CTGGGTATTCAGAGAGACCATGG - Intergenic
959737063 3:109671456-109671478 CTGGATATAAAGACAGACATAGG + Intergenic
960366960 3:116784592-116784614 CTGGATTTACTGAGAAACAAAGG - Intronic
962400240 3:135052393-135052415 CTGGTTAGAGAAAGAGAAAAAGG + Intronic
962497319 3:135954262-135954284 CAGAATATATAAGGAGACAAGGG - Intergenic
962497325 3:135954318-135954340 CAGAATATATAAGGAGACAAGGG - Intergenic
963569776 3:146978850-146978872 CTGGATATACAAAGCAGAAATGG + Intergenic
963913658 3:150837976-150837998 CTGGATAAACAATGAAATAAAGG - Intergenic
964706114 3:159620464-159620486 CTGGATAAAGAAATAGACAATGG + Intronic
964896464 3:161602471-161602493 CTGCATATTCAGAGAGATAAAGG + Intergenic
965130235 3:164689654-164689676 ATGGTAATCCAAAGAGACAAAGG + Intergenic
965229817 3:166035956-166035978 CTAGATTAACAAAGAGAAAAAGG - Intergenic
965276295 3:166686959-166686981 CTGGTTATACACTGAGAAAATGG - Intergenic
965540867 3:169870291-169870313 ATGAATATGCAAAGAGAAAAAGG - Intergenic
966056684 3:175701419-175701441 CTGAATATACAAATTGACGATGG - Intronic
966264897 3:178027988-178028010 CTGGATATAAGAATAGAGAAAGG + Intergenic
968247746 3:197170797-197170819 CTGGATATAGGAACAGGCAAAGG - Intronic
970316764 4:14835460-14835482 CTGACTATCCAAACAGACAATGG + Intergenic
971146163 4:23978981-23979003 TTGCATATAGAAAGAGACAGGGG + Intergenic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
972148541 4:36060796-36060818 TAGGACATACAAAGAGACACTGG - Intronic
972714701 4:41633828-41633850 CTGGAGAAACAAAGTCACAAGGG - Intronic
972865274 4:43224850-43224872 CTGGAGATACAAAGAAAAACTGG + Intergenic
973849558 4:54947698-54947720 TTGGACATACAAAGAGGCACTGG + Intergenic
973892961 4:55386320-55386342 CTGGAAAAACAAGGAGACACAGG - Intergenic
974466059 4:62258087-62258109 CTGGAGACACAGAGAGAAAATGG - Intergenic
974762275 4:66292988-66293010 CTGGCAATGCAAAGAGAAAAGGG + Intergenic
974784065 4:66594676-66594698 ATGGAGACAAAAAGAGACAAAGG + Intergenic
975749151 4:77505152-77505174 CCAGATATACAGATAGACAAAGG - Intergenic
975755548 4:77568103-77568125 CTGGTAACACAAAGGGACAATGG + Intronic
976472461 4:85445646-85445668 CTGGTTAGAAAAAGAGAGAAGGG - Intergenic
977325350 4:95568356-95568378 CTGGATTAACAAAGACAAAAAGG - Intergenic
977786491 4:101041168-101041190 TTGGATTTAGTAAGAGACAATGG + Intronic
978038100 4:104021791-104021813 TTGAATATATAAACAGACAATGG + Intergenic
979072530 4:116226993-116227015 CTGAATATTCAAATAGCCAAAGG + Intergenic
981248894 4:142574785-142574807 CTGTATAAACAAACAAACAAAGG - Intronic
981833331 4:149027326-149027348 CTGTATATACACAGAGAATAAGG - Intergenic
981955775 4:150471478-150471500 AAGGATATACAAAGAGAATAAGG - Intronic
982173460 4:152683404-152683426 CTGGATGTACAAATGGACAGTGG - Intergenic
983387363 4:167082423-167082445 CTTTATTTACAAACAGACAATGG - Intronic
983438202 4:167744716-167744738 CAGGATAGAAGAAGAGACAAAGG + Intergenic
983603493 4:169557630-169557652 CTGGTTAAAAAAAGAAACAAAGG + Intronic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
986812968 5:11379749-11379771 CTGGAATTACAAAGAAAAAATGG - Intronic
987691667 5:21274847-21274869 CTGAATACACTAACAGACAATGG - Intergenic
988684076 5:33511330-33511352 ATGAATACACAAATAGACAATGG + Intergenic
989498889 5:42142401-42142423 CTGGATACAGAAAGAGAAAGAGG + Intergenic
990255787 5:53967484-53967506 CTGGATATGGGAGGAGACAAAGG + Intronic
990677974 5:58209783-58209805 CTGGATGTTCAATGAGACAGAGG - Intergenic
991748710 5:69775290-69775312 CTGAATACACTAACAGACAATGG + Intergenic
991800288 5:70355102-70355124 CTGAATACACTAACAGACAATGG + Intergenic
991828312 5:70654939-70654961 CTGAATACACTAACAGACAATGG - Intergenic
991892646 5:71354542-71354564 CTGAATACACTAACAGACAATGG + Intergenic
991912465 5:71575258-71575280 CTGGAAAAACAAATAGAAAAGGG + Intergenic
992553819 5:77884416-77884438 CTGTATATACAGAGTGAGAAAGG + Intergenic
992632999 5:78699944-78699966 CTGGATATTCAGGGAAACAAGGG - Intronic
993527717 5:88986948-88986970 ATGGAAATACACAGAGACATTGG + Intergenic
993779484 5:92048408-92048430 CTAGGTAAACAAAGAGAAAAAGG - Intergenic
995027994 5:107446869-107446891 CAGGATATATAAATACACAAAGG + Intronic
995925956 5:117374630-117374652 CTGGATAAACAAAGAGGTATAGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
997389742 5:133504292-133504314 CTGGATATGGAAAGTGAAAAAGG - Intronic
997715168 5:136037116-136037138 CTGCATTTACAAAGAGAGAAGGG + Intronic
997810061 5:136958281-136958303 CTAGATATACAAACAGAGAATGG - Intergenic
998192245 5:140036148-140036170 CTGCATATACAAAGTGGGAAGGG + Intronic
999345390 5:150814321-150814343 CTGGACACACAAAAAGAAAATGG + Intergenic
1000257301 5:159552195-159552217 CTGTAAATACAATGAGGCAAGGG - Intergenic
1003673677 6:8182797-8182819 CTGAAAATACAAATAGACAGAGG - Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004932933 6:20479229-20479251 CTGTATATTCAATGAGAGAAAGG - Intronic
1004932941 6:20479305-20479327 CTGGGTATACAAAGATAAATGGG + Intronic
1005184728 6:23152725-23152747 CTGGAGATATAAATATACAAAGG - Intergenic
1005315825 6:24601942-24601964 CTGGATATAAAAGCAGACAATGG - Intronic
1005404439 6:25470986-25471008 CTGGAAATACAATGATATAAAGG - Intronic
1005553732 6:26952084-26952106 CTAGATAAACAAAGAAAAAAAGG + Intergenic
1006214245 6:32426125-32426147 CTGGATATAGAAACAGACAATGG + Intergenic
1007154922 6:39733167-39733189 CTGGAAATACAAAGATAAACAGG - Intergenic
1007968308 6:46024441-46024463 CTGGACTTATAAAGAGACTAGGG + Intronic
1008193692 6:48492002-48492024 CTGAAAACACAAAGAAACAAGGG - Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1009819639 6:68783497-68783519 CTAGGTAAACAAAAAGACAAGGG + Intronic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011954470 6:93008964-93008986 CTGAATATGCAAAGAAGCAATGG + Intergenic
1012019414 6:93898314-93898336 CTGGAGACACAGAGAGACACAGG - Intergenic
1012629703 6:101449670-101449692 CTGGAGACACAGAGACACAAAGG - Intronic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1014271617 6:119342871-119342893 CTGTATATACAAAGGGTGAAAGG - Intronic
1014475122 6:121862613-121862635 CTGGAGATACAAAGAGGAGATGG - Intergenic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1014865907 6:126529848-126529870 AAGGAAATAAAAAGAGACAAGGG + Intergenic
1014944873 6:127485524-127485546 AGAGATATACAAAGACACAAGGG + Intronic
1015724192 6:136283702-136283724 CTGGAAATACAAAGAAGAAATGG + Intronic
1015899416 6:138049329-138049351 GTGTATATATAGAGAGACAAAGG - Intergenic
1016159473 6:140859880-140859902 CTGGATCTAGAAAGAGAGGAAGG - Intergenic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017215627 6:151902658-151902680 TTTGACAAACAAAGAGACAAAGG - Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018863108 6:167726335-167726357 TAGGAAATACAAAGAGAAAATGG + Intergenic
1020150576 7:5678838-5678860 CTGGATAAATTAAGAGGCAAAGG + Intronic
1020830721 7:13091508-13091530 CTGAAGACACAAATAGACAATGG - Intergenic
1020985526 7:15129289-15129311 CTGGATATACAACTGAACAATGG - Intergenic
1021602386 7:22377434-22377456 CTGGATTTACAACCAGACATGGG + Intergenic
1021792659 7:24221590-24221612 AAGGATATACAAATAGACAATGG + Intergenic
1022030429 7:26487491-26487513 CTGGCTTTGCAGAGAGACAAGGG - Intergenic
1022047743 7:26636205-26636227 CTGTGTATACCAAGGGACAACGG + Intergenic
1022108814 7:27215188-27215210 CTGGATATCTACAGAAACAATGG - Intergenic
1022592101 7:31673387-31673409 CTGAAAATAGAAACAGACAATGG - Intergenic
1023517291 7:41014441-41014463 CTGGATTTAAAAAGTGAGAAGGG + Intergenic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024964232 7:55007387-55007409 CTTGTTTCACAAAGAGACAAAGG - Intergenic
1028421946 7:90642957-90642979 CTGGAGATGCAAAGTGAGAAAGG + Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029838864 7:103341450-103341472 TAAGATATACAAAGACACAAAGG - Intronic
1030244211 7:107363159-107363181 CTGGAAAGTCAGAGAGACAATGG + Intronic
1030504032 7:110397157-110397179 CTCCATATACATAGAGATAAAGG + Intergenic
1031164887 7:118216072-118216094 GTGAATGTACAAATAGACAATGG + Intronic
1031209007 7:118797911-118797933 CCTGATATTCAAAGAAACAATGG + Intergenic
1031331713 7:120473843-120473865 CTGGATATACTGGGAGAGAAAGG + Intronic
1031402962 7:121347031-121347053 CTTGATAGCCAAAGAGAAAAGGG - Intergenic
1031671146 7:124547992-124548014 CAGGAAATCCAAAGAGATAATGG - Intergenic
1031719473 7:125153310-125153332 CAGGATATAGAAACACACAAGGG - Intergenic
1032112625 7:129089665-129089687 ATGAAAATACAAACAGACAATGG + Intergenic
1032185966 7:129726627-129726649 CTGGATATACAGTGAGTCAAAGG + Intronic
1032696684 7:134342798-134342820 CTGGATCTATAAGGAGATAAGGG - Intergenic
1033197993 7:139343624-139343646 CTAGATATTCAAATAGAGAAAGG + Intronic
1033344445 7:140516493-140516515 CTGCATGTATAAAGAGCCAAAGG + Intergenic
1033363455 7:140654143-140654165 CTGAATACGCAAAGGGACAATGG - Intronic
1033528510 7:142240891-142240913 ATGGAGAGACAAAGATACAAAGG + Intergenic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1035556242 8:569297-569319 CCGAATATGCAAACAGACAAGGG - Intergenic
1036909799 8:12747134-12747156 CTGGGTATAAAAGGAGAAAATGG - Intronic
1037968198 8:23150033-23150055 CTGGAAACACATAGAGATAAGGG + Intronic
1038016603 8:23521187-23521209 GAGGATATAAGAAGAGACAAGGG + Intergenic
1038252519 8:25918798-25918820 CGTTATATACAAGGAGACAAAGG - Intronic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1038759924 8:30376750-30376772 CTAGATTTAAAAAGAGACGATGG - Intergenic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1039414484 8:37381892-37381914 CAGGAAATACCAAGACACAAAGG + Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040465209 8:47688609-47688631 CTGCATGAACAAAGAGACTATGG - Intronic
1043194978 8:77280695-77280717 TTGGACATACAAAGAGACACAGG - Intergenic
1043210270 8:77505233-77505255 GTGGATAAAGAAAGGGACAAAGG - Intergenic
1043359387 8:79453630-79453652 CTAGATATACAGAGTAACAATGG + Intergenic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1043458924 8:80439814-80439836 ATGGATATTCACAGAGAAAAAGG + Intergenic
1044060794 8:87632260-87632282 TTGAATATACATAGAGAGAAAGG + Intergenic
1044160905 8:88913811-88913833 TTGGATATTCAAAGATACAGAGG - Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044459088 8:92424158-92424180 CTAAATATACCAAGAGAGAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1044850562 8:96423290-96423312 CTGGATATACGAATGGGCAAAGG - Intergenic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1045579565 8:103463667-103463689 CTGGATCTGGAAAGAAACAAAGG + Intergenic
1046124462 8:109886811-109886833 ATGAATATACAAAGACATAAAGG + Intergenic
1047649103 8:126900502-126900524 TTGGACATACAAAGGGACCAAGG - Intergenic
1048184522 8:132227386-132227408 CTGGAGACACAAAGAGGCACTGG + Intronic
1049892344 9:82386-82408 CTGGTTTTAAAAAGAGACAAGGG + Intergenic
1050483638 9:6111900-6111922 CTGAATATACAAATAAACACTGG + Intergenic
1050538253 9:6648521-6648543 CTGGAAAGACAAAGACATAATGG + Intergenic
1051001814 9:12291157-12291179 CTGAATATACAAACAAACAATGG - Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1052448788 9:28598771-28598793 CTGGATTTTAAAAGAGAGAATGG - Intronic
1053733763 9:41083463-41083485 CTGGTTTTAAAAAGAGACAAGGG + Intergenic
1054694646 9:68348089-68348111 CGGGTTTTAAAAAGAGACAAGGG - Intronic
1056602016 9:88053874-88053896 CTGAGTACACAAACAGACAATGG + Intergenic
1056627617 9:88266472-88266494 CTGAAAATGCAAATAGACAATGG + Intergenic
1057665532 9:97042099-97042121 CTGAGTAAACAAATAGACAATGG - Intergenic
1058713191 9:107698763-107698785 CTGGAATCACAAAGAGACATGGG - Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059301039 9:113313779-113313801 CTGGAAAGACAAAGAGATAGTGG - Exonic
1059645802 9:116265794-116265816 CTGGGCAGACAAAGAGAGAATGG - Intronic
1059714996 9:116905344-116905366 CAGGATATAAAAGGAGACGAAGG + Intronic
1059735580 9:117096604-117096626 CTGGAGATACAAAGATAAATAGG + Intronic
1186620366 X:11234438-11234460 CTGGAAATACAAACAAACATTGG - Intronic
1187764649 X:22627671-22627693 CTGGGAATACAAGGAGAAAAAGG + Intergenic
1188295408 X:28441198-28441220 TTGAATATACAAAGGAACAAGGG - Intergenic
1188329174 X:28847540-28847562 ATGGATATACTAAGAGGCATTGG - Intronic
1189353006 X:40291102-40291124 CTGGATTTACAAAGAAAAAAGGG + Intergenic
1189894219 X:45636953-45636975 CTAGATTAACAAAGAAACAAAGG + Intergenic
1190139419 X:47829267-47829289 CTGAATATACAAACAGGCAATGG - Intergenic
1190898762 X:54648182-54648204 ATGGAAATACAAAGAGAAAAAGG - Intergenic
1192615726 X:72620181-72620203 CTGGATATGAAAGGAGAGAAGGG - Intronic
1194484139 X:94466160-94466182 CTGGACATAGAAACAGGCAAAGG + Intergenic
1195221833 X:102751834-102751856 ATGGATAGAAAAAGATACAAAGG - Exonic
1196527344 X:116741524-116741546 CTGGGTATAGAGAGGGACAACGG - Intergenic
1196633382 X:117970080-117970102 CTGGGTTTAGAAAGAGACCATGG + Intronic
1196835367 X:119808730-119808752 CAGGCTAGACAAAGAGGCAAGGG + Intergenic
1196837226 X:119824508-119824530 CAGGCTAGACAAAGAGGCAAGGG + Intergenic
1196981258 X:121216079-121216101 AAGGATAGACAAATAGACAAAGG - Intergenic
1196988542 X:121301871-121301893 CTGGATATGGAAAGAGACTTGGG + Intergenic
1197398084 X:125952490-125952512 CTGGAAAAACAAGGAGAAAAAGG - Intergenic
1197921669 X:131601198-131601220 CTGGATAAAGAAAAACACAATGG - Intergenic
1197936775 X:131747655-131747677 ATGGACATACAAAAAGAAAAGGG + Intergenic
1199133295 X:144220154-144220176 CTGAAGATAGATAGAGACAAAGG - Intergenic
1199204143 X:145128089-145128111 TCGAATATACAAACAGACAACGG + Intergenic
1200781479 Y:7220248-7220270 CTGAAAATATAAACAGACAATGG + Intergenic
1200797844 Y:7358016-7358038 CTGGGTATGTAAAGAGACAGGGG - Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic