ID: 925452843

View in Genome Browser
Species Human (GRCh38)
Location 2:3985370-3985392
Sequence GGTCATCTTCCCACACCATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925452837_925452843 25 Left 925452837 2:3985322-3985344 CCGGGCAGGGGTGGGGGGTGGTG No data
Right 925452843 2:3985370-3985392 GGTCATCTTCCCACACCATCAGG No data
925452839_925452843 0 Left 925452839 2:3985347-3985369 CCTTGGCTGTTTCCCTCTCTGTA No data
Right 925452843 2:3985370-3985392 GGTCATCTTCCCACACCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925452843 Original CRISPR GGTCATCTTCCCACACCATC AGG Intergenic
No off target data available for this crispr