ID: 925456868

View in Genome Browser
Species Human (GRCh38)
Location 2:4023469-4023491
Sequence GACACTGAGCTGGCTGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925456868_925456874 5 Left 925456868 2:4023469-4023491 CCTGCTGCAGCCAGCTCAGTGTC No data
Right 925456874 2:4023497-4023519 GTGATCTTGGCACTGGCATATGG No data
925456868_925456871 -2 Left 925456868 2:4023469-4023491 CCTGCTGCAGCCAGCTCAGTGTC No data
Right 925456871 2:4023490-4023512 TCACCCTGTGATCTTGGCACTGG No data
925456868_925456875 21 Left 925456868 2:4023469-4023491 CCTGCTGCAGCCAGCTCAGTGTC No data
Right 925456875 2:4023513-4023535 CATATGGTCTCCTGAGTTTTTGG No data
925456868_925456870 -8 Left 925456868 2:4023469-4023491 CCTGCTGCAGCCAGCTCAGTGTC No data
Right 925456870 2:4023484-4023506 TCAGTGTCACCCTGTGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925456868 Original CRISPR GACACTGAGCTGGCTGCAGC AGG (reversed) Intergenic
No off target data available for this crispr