ID: 925459853

View in Genome Browser
Species Human (GRCh38)
Location 2:4051540-4051562
Sequence CTTTGGAAGGTGGAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925459848_925459853 -8 Left 925459848 2:4051525-4051547 CCTGTAATCTTAGTACTTTGGAA No data
Right 925459853 2:4051540-4051562 CTTTGGAAGGTGGAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925459853 Original CRISPR CTTTGGAAGGTGGAGGTGGA AGG Intergenic
No off target data available for this crispr