ID: 925460727 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:4060453-4060475 |
| Sequence | GACAGCTCTTTGTCTATTAC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 925460725_925460727 | 11 | Left | 925460725 | 2:4060419-4060441 | CCATCTTCTGCAGATAACTACTC | 0: 178 1: 192 2: 102 3: 110 4: 247 |
||
| Right | 925460727 | 2:4060453-4060475 | GACAGCTCTTTGTCTATTACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 925460727 | Original CRISPR | GACAGCTCTTTGTCTATTAC TGG | Intergenic | ||
| No off target data available for this crispr | |||||