ID: 925460727

View in Genome Browser
Species Human (GRCh38)
Location 2:4060453-4060475
Sequence GACAGCTCTTTGTCTATTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925460725_925460727 11 Left 925460725 2:4060419-4060441 CCATCTTCTGCAGATAACTACTC 0: 178
1: 192
2: 102
3: 110
4: 247
Right 925460727 2:4060453-4060475 GACAGCTCTTTGTCTATTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925460727 Original CRISPR GACAGCTCTTTGTCTATTAC TGG Intergenic
No off target data available for this crispr