ID: 925466059

View in Genome Browser
Species Human (GRCh38)
Location 2:4108366-4108388
Sequence AGGACTGCAGGCGACCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925466059_925466068 16 Left 925466059 2:4108366-4108388 CCTTCCAGGTCGCCTGCAGTCCT No data
Right 925466068 2:4108405-4108427 GGAACACAATTGAAAAGGCAGGG No data
925466059_925466067 15 Left 925466059 2:4108366-4108388 CCTTCCAGGTCGCCTGCAGTCCT No data
Right 925466067 2:4108404-4108426 GGGAACACAATTGAAAAGGCAGG No data
925466059_925466063 -5 Left 925466059 2:4108366-4108388 CCTTCCAGGTCGCCTGCAGTCCT No data
Right 925466063 2:4108384-4108406 GTCCTTGCAGCTTCCTCTGTGGG No data
925466059_925466066 11 Left 925466059 2:4108366-4108388 CCTTCCAGGTCGCCTGCAGTCCT No data
Right 925466066 2:4108400-4108422 CTGTGGGAACACAATTGAAAAGG No data
925466059_925466062 -6 Left 925466059 2:4108366-4108388 CCTTCCAGGTCGCCTGCAGTCCT No data
Right 925466062 2:4108383-4108405 AGTCCTTGCAGCTTCCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925466059 Original CRISPR AGGACTGCAGGCGACCTGGA AGG (reversed) Intergenic