ID: 925466060

View in Genome Browser
Species Human (GRCh38)
Location 2:4108370-4108392
Sequence TGCAAGGACTGCAGGCGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925466060_925466062 -10 Left 925466060 2:4108370-4108392 CCAGGTCGCCTGCAGTCCTTGCA No data
Right 925466062 2:4108383-4108405 AGTCCTTGCAGCTTCCTCTGTGG No data
925466060_925466068 12 Left 925466060 2:4108370-4108392 CCAGGTCGCCTGCAGTCCTTGCA No data
Right 925466068 2:4108405-4108427 GGAACACAATTGAAAAGGCAGGG No data
925466060_925466067 11 Left 925466060 2:4108370-4108392 CCAGGTCGCCTGCAGTCCTTGCA No data
Right 925466067 2:4108404-4108426 GGGAACACAATTGAAAAGGCAGG 0: 1
1: 0
2: 1
3: 17
4: 181
925466060_925466063 -9 Left 925466060 2:4108370-4108392 CCAGGTCGCCTGCAGTCCTTGCA No data
Right 925466063 2:4108384-4108406 GTCCTTGCAGCTTCCTCTGTGGG No data
925466060_925466066 7 Left 925466060 2:4108370-4108392 CCAGGTCGCCTGCAGTCCTTGCA No data
Right 925466066 2:4108400-4108422 CTGTGGGAACACAATTGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925466060 Original CRISPR TGCAAGGACTGCAGGCGACC TGG (reversed) Intergenic