ID: 925466061

View in Genome Browser
Species Human (GRCh38)
Location 2:4108378-4108400
Sequence GAGGAAGCTGCAAGGACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925466061_925466070 24 Left 925466061 2:4108378-4108400 CCTGCAGTCCTTGCAGCTTCCTC No data
Right 925466070 2:4108425-4108447 GGGAAACCCTTGCTTCATCAGGG No data
925466061_925466069 23 Left 925466061 2:4108378-4108400 CCTGCAGTCCTTGCAGCTTCCTC No data
Right 925466069 2:4108424-4108446 AGGGAAACCCTTGCTTCATCAGG No data
925466061_925466068 4 Left 925466061 2:4108378-4108400 CCTGCAGTCCTTGCAGCTTCCTC No data
Right 925466068 2:4108405-4108427 GGAACACAATTGAAAAGGCAGGG No data
925466061_925466067 3 Left 925466061 2:4108378-4108400 CCTGCAGTCCTTGCAGCTTCCTC No data
Right 925466067 2:4108404-4108426 GGGAACACAATTGAAAAGGCAGG 0: 1
1: 0
2: 1
3: 17
4: 181
925466061_925466066 -1 Left 925466061 2:4108378-4108400 CCTGCAGTCCTTGCAGCTTCCTC No data
Right 925466066 2:4108400-4108422 CTGTGGGAACACAATTGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925466061 Original CRISPR GAGGAAGCTGCAAGGACTGC AGG (reversed) Intergenic