ID: 925466062

View in Genome Browser
Species Human (GRCh38)
Location 2:4108383-4108405
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925466054_925466062 24 Left 925466054 2:4108336-4108358 CCCTGGGGACCAGGGAAGAAGAA No data
Right 925466062 2:4108383-4108405 AGTCCTTGCAGCTTCCTCTGTGG No data
925466059_925466062 -6 Left 925466059 2:4108366-4108388 CCTTCCAGGTCGCCTGCAGTCCT No data
Right 925466062 2:4108383-4108405 AGTCCTTGCAGCTTCCTCTGTGG No data
925466058_925466062 -5 Left 925466058 2:4108365-4108387 CCCTTCCAGGTCGCCTGCAGTCC No data
Right 925466062 2:4108383-4108405 AGTCCTTGCAGCTTCCTCTGTGG No data
925466056_925466062 15 Left 925466056 2:4108345-4108367 CCAGGGAAGAAGAATGTTGTCCC No data
Right 925466062 2:4108383-4108405 AGTCCTTGCAGCTTCCTCTGTGG No data
925466055_925466062 23 Left 925466055 2:4108337-4108359 CCTGGGGACCAGGGAAGAAGAAT No data
Right 925466062 2:4108383-4108405 AGTCCTTGCAGCTTCCTCTGTGG No data
925466060_925466062 -10 Left 925466060 2:4108370-4108392 CCAGGTCGCCTGCAGTCCTTGCA No data
Right 925466062 2:4108383-4108405 AGTCCTTGCAGCTTCCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type