ID: 925466064

View in Genome Browser
Species Human (GRCh38)
Location 2:4108386-4108408
Sequence TTCCCACAGAGGAAGCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925466064_925466074 27 Left 925466064 2:4108386-4108408 CCTTGCAGCTTCCTCTGTGGGAA No data
Right 925466074 2:4108436-4108458 GCTTCATCAGGGCAGTGTTTGGG No data
925466064_925466066 -9 Left 925466064 2:4108386-4108408 CCTTGCAGCTTCCTCTGTGGGAA No data
Right 925466066 2:4108400-4108422 CTGTGGGAACACAATTGAAAAGG No data
925466064_925466067 -5 Left 925466064 2:4108386-4108408 CCTTGCAGCTTCCTCTGTGGGAA No data
Right 925466067 2:4108404-4108426 GGGAACACAATTGAAAAGGCAGG 0: 1
1: 0
2: 1
3: 17
4: 181
925466064_925466073 26 Left 925466064 2:4108386-4108408 CCTTGCAGCTTCCTCTGTGGGAA No data
Right 925466073 2:4108435-4108457 TGCTTCATCAGGGCAGTGTTTGG No data
925466064_925466068 -4 Left 925466064 2:4108386-4108408 CCTTGCAGCTTCCTCTGTGGGAA No data
Right 925466068 2:4108405-4108427 GGAACACAATTGAAAAGGCAGGG No data
925466064_925466069 15 Left 925466064 2:4108386-4108408 CCTTGCAGCTTCCTCTGTGGGAA No data
Right 925466069 2:4108424-4108446 AGGGAAACCCTTGCTTCATCAGG No data
925466064_925466070 16 Left 925466064 2:4108386-4108408 CCTTGCAGCTTCCTCTGTGGGAA No data
Right 925466070 2:4108425-4108447 GGGAAACCCTTGCTTCATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925466064 Original CRISPR TTCCCACAGAGGAAGCTGCA AGG (reversed) Intergenic