ID: 925466066

View in Genome Browser
Species Human (GRCh38)
Location 2:4108400-4108422
Sequence CTGTGGGAACACAATTGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925466060_925466066 7 Left 925466060 2:4108370-4108392 CCAGGTCGCCTGCAGTCCTTGCA No data
Right 925466066 2:4108400-4108422 CTGTGGGAACACAATTGAAAAGG No data
925466058_925466066 12 Left 925466058 2:4108365-4108387 CCCTTCCAGGTCGCCTGCAGTCC No data
Right 925466066 2:4108400-4108422 CTGTGGGAACACAATTGAAAAGG No data
925466059_925466066 11 Left 925466059 2:4108366-4108388 CCTTCCAGGTCGCCTGCAGTCCT No data
Right 925466066 2:4108400-4108422 CTGTGGGAACACAATTGAAAAGG No data
925466064_925466066 -9 Left 925466064 2:4108386-4108408 CCTTGCAGCTTCCTCTGTGGGAA No data
Right 925466066 2:4108400-4108422 CTGTGGGAACACAATTGAAAAGG No data
925466061_925466066 -1 Left 925466061 2:4108378-4108400 CCTGCAGTCCTTGCAGCTTCCTC No data
Right 925466066 2:4108400-4108422 CTGTGGGAACACAATTGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925466066 Original CRISPR CTGTGGGAACACAATTGAAA AGG Intergenic