ID: 925466070

View in Genome Browser
Species Human (GRCh38)
Location 2:4108425-4108447
Sequence GGGAAACCCTTGCTTCATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925466064_925466070 16 Left 925466064 2:4108386-4108408 CCTTGCAGCTTCCTCTGTGGGAA No data
Right 925466070 2:4108425-4108447 GGGAAACCCTTGCTTCATCAGGG No data
925466061_925466070 24 Left 925466061 2:4108378-4108400 CCTGCAGTCCTTGCAGCTTCCTC No data
Right 925466070 2:4108425-4108447 GGGAAACCCTTGCTTCATCAGGG No data
925466065_925466070 5 Left 925466065 2:4108397-4108419 CCTCTGTGGGAACACAATTGAAA No data
Right 925466070 2:4108425-4108447 GGGAAACCCTTGCTTCATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925466070 Original CRISPR GGGAAACCCTTGCTTCATCA GGG Intergenic