ID: 925467842

View in Genome Browser
Species Human (GRCh38)
Location 2:4125618-4125640
Sequence CAGCAGCTCTAGGGGAACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925467842_925467852 18 Left 925467842 2:4125618-4125640 CCTTGGTTCCCCTAGAGCTGCTG No data
Right 925467852 2:4125659-4125681 GTCCCTGGCTGTTGACCAGAAGG No data
925467842_925467850 3 Left 925467842 2:4125618-4125640 CCTTGGTTCCCCTAGAGCTGCTG No data
Right 925467850 2:4125644-4125666 CACGGGCCTCAGTTTGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925467842 Original CRISPR CAGCAGCTCTAGGGGAACCA AGG (reversed) Intergenic
No off target data available for this crispr