ID: 925474552

View in Genome Browser
Species Human (GRCh38)
Location 2:4198403-4198425
Sequence AGGCAGCGTCTCCCTCTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925474552_925474560 22 Left 925474552 2:4198403-4198425 CCATAAAGAGGGAGACGCTGCCT No data
Right 925474560 2:4198448-4198470 TGTGTGCGCGCGGCAGGGAAGGG No data
925474552_925474561 25 Left 925474552 2:4198403-4198425 CCATAAAGAGGGAGACGCTGCCT No data
Right 925474561 2:4198451-4198473 GTGCGCGCGGCAGGGAAGGGAGG No data
925474552_925474554 -8 Left 925474552 2:4198403-4198425 CCATAAAGAGGGAGACGCTGCCT No data
Right 925474554 2:4198418-4198440 CGCTGCCTGAGACACAGCGTGGG No data
925474552_925474557 16 Left 925474552 2:4198403-4198425 CCATAAAGAGGGAGACGCTGCCT No data
Right 925474557 2:4198442-4198464 AGTGCATGTGTGCGCGCGGCAGG No data
925474552_925474558 17 Left 925474552 2:4198403-4198425 CCATAAAGAGGGAGACGCTGCCT No data
Right 925474558 2:4198443-4198465 GTGCATGTGTGCGCGCGGCAGGG No data
925474552_925474556 12 Left 925474552 2:4198403-4198425 CCATAAAGAGGGAGACGCTGCCT No data
Right 925474556 2:4198438-4198460 GGGCAGTGCATGTGTGCGCGCGG No data
925474552_925474553 -9 Left 925474552 2:4198403-4198425 CCATAAAGAGGGAGACGCTGCCT No data
Right 925474553 2:4198417-4198439 ACGCTGCCTGAGACACAGCGTGG No data
925474552_925474559 21 Left 925474552 2:4198403-4198425 CCATAAAGAGGGAGACGCTGCCT No data
Right 925474559 2:4198447-4198469 ATGTGTGCGCGCGGCAGGGAAGG No data
925474552_925474562 26 Left 925474552 2:4198403-4198425 CCATAAAGAGGGAGACGCTGCCT No data
Right 925474562 2:4198452-4198474 TGCGCGCGGCAGGGAAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925474552 Original CRISPR AGGCAGCGTCTCCCTCTTTA TGG (reversed) Intergenic