ID: 925474555

View in Genome Browser
Species Human (GRCh38)
Location 2:4198423-4198445
Sequence CACTGCCCACGCTGTGTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925474555_925474559 1 Left 925474555 2:4198423-4198445 CCTGAGACACAGCGTGGGCAGTG No data
Right 925474559 2:4198447-4198469 ATGTGTGCGCGCGGCAGGGAAGG No data
925474555_925474561 5 Left 925474555 2:4198423-4198445 CCTGAGACACAGCGTGGGCAGTG No data
Right 925474561 2:4198451-4198473 GTGCGCGCGGCAGGGAAGGGAGG No data
925474555_925474558 -3 Left 925474555 2:4198423-4198445 CCTGAGACACAGCGTGGGCAGTG No data
Right 925474558 2:4198443-4198465 GTGCATGTGTGCGCGCGGCAGGG No data
925474555_925474556 -8 Left 925474555 2:4198423-4198445 CCTGAGACACAGCGTGGGCAGTG No data
Right 925474556 2:4198438-4198460 GGGCAGTGCATGTGTGCGCGCGG No data
925474555_925474565 28 Left 925474555 2:4198423-4198445 CCTGAGACACAGCGTGGGCAGTG No data
Right 925474565 2:4198474-4198496 GCCATGCACCCTTGACAGGGAGG No data
925474555_925474563 24 Left 925474555 2:4198423-4198445 CCTGAGACACAGCGTGGGCAGTG No data
Right 925474563 2:4198470-4198492 GAGGGCCATGCACCCTTGACAGG No data
925474555_925474557 -4 Left 925474555 2:4198423-4198445 CCTGAGACACAGCGTGGGCAGTG No data
Right 925474557 2:4198442-4198464 AGTGCATGTGTGCGCGCGGCAGG No data
925474555_925474560 2 Left 925474555 2:4198423-4198445 CCTGAGACACAGCGTGGGCAGTG No data
Right 925474560 2:4198448-4198470 TGTGTGCGCGCGGCAGGGAAGGG No data
925474555_925474562 6 Left 925474555 2:4198423-4198445 CCTGAGACACAGCGTGGGCAGTG No data
Right 925474562 2:4198452-4198474 TGCGCGCGGCAGGGAAGGGAGGG No data
925474555_925474564 25 Left 925474555 2:4198423-4198445 CCTGAGACACAGCGTGGGCAGTG No data
Right 925474564 2:4198471-4198493 AGGGCCATGCACCCTTGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925474555 Original CRISPR CACTGCCCACGCTGTGTCTC AGG (reversed) Intergenic