ID: 925474556

View in Genome Browser
Species Human (GRCh38)
Location 2:4198438-4198460
Sequence GGGCAGTGCATGTGTGCGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925474555_925474556 -8 Left 925474555 2:4198423-4198445 CCTGAGACACAGCGTGGGCAGTG No data
Right 925474556 2:4198438-4198460 GGGCAGTGCATGTGTGCGCGCGG No data
925474552_925474556 12 Left 925474552 2:4198403-4198425 CCATAAAGAGGGAGACGCTGCCT No data
Right 925474556 2:4198438-4198460 GGGCAGTGCATGTGTGCGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925474556 Original CRISPR GGGCAGTGCATGTGTGCGCG CGG Intergenic