ID: 925474557 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:4198442-4198464 |
| Sequence | AGTGCATGTGTGCGCGCGGC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 925474552_925474557 | 16 | Left | 925474552 | 2:4198403-4198425 | CCATAAAGAGGGAGACGCTGCCT | No data | ||
| Right | 925474557 | 2:4198442-4198464 | AGTGCATGTGTGCGCGCGGCAGG | No data | ||||
| 925474555_925474557 | -4 | Left | 925474555 | 2:4198423-4198445 | CCTGAGACACAGCGTGGGCAGTG | No data | ||
| Right | 925474557 | 2:4198442-4198464 | AGTGCATGTGTGCGCGCGGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 925474557 | Original CRISPR | AGTGCATGTGTGCGCGCGGC AGG | Intergenic | ||