ID: 925474559 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:4198447-4198469 |
Sequence | ATGTGTGCGCGCGGCAGGGA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
925474555_925474559 | 1 | Left | 925474555 | 2:4198423-4198445 | CCTGAGACACAGCGTGGGCAGTG | No data | ||
Right | 925474559 | 2:4198447-4198469 | ATGTGTGCGCGCGGCAGGGAAGG | No data | ||||
925474552_925474559 | 21 | Left | 925474552 | 2:4198403-4198425 | CCATAAAGAGGGAGACGCTGCCT | No data | ||
Right | 925474559 | 2:4198447-4198469 | ATGTGTGCGCGCGGCAGGGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
925474559 | Original CRISPR | ATGTGTGCGCGCGGCAGGGA AGG | Intergenic | ||