ID: 925474561

View in Genome Browser
Species Human (GRCh38)
Location 2:4198451-4198473
Sequence GTGCGCGCGGCAGGGAAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925474555_925474561 5 Left 925474555 2:4198423-4198445 CCTGAGACACAGCGTGGGCAGTG No data
Right 925474561 2:4198451-4198473 GTGCGCGCGGCAGGGAAGGGAGG No data
925474552_925474561 25 Left 925474552 2:4198403-4198425 CCATAAAGAGGGAGACGCTGCCT No data
Right 925474561 2:4198451-4198473 GTGCGCGCGGCAGGGAAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925474561 Original CRISPR GTGCGCGCGGCAGGGAAGGG AGG Intergenic