ID: 925474563

View in Genome Browser
Species Human (GRCh38)
Location 2:4198470-4198492
Sequence GAGGGCCATGCACCCTTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925474555_925474563 24 Left 925474555 2:4198423-4198445 CCTGAGACACAGCGTGGGCAGTG No data
Right 925474563 2:4198470-4198492 GAGGGCCATGCACCCTTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925474563 Original CRISPR GAGGGCCATGCACCCTTGAC AGG Intergenic