ID: 925474564

View in Genome Browser
Species Human (GRCh38)
Location 2:4198471-4198493
Sequence AGGGCCATGCACCCTTGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925474555_925474564 25 Left 925474555 2:4198423-4198445 CCTGAGACACAGCGTGGGCAGTG No data
Right 925474564 2:4198471-4198493 AGGGCCATGCACCCTTGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925474564 Original CRISPR AGGGCCATGCACCCTTGACA GGG Intergenic