ID: 925478831

View in Genome Browser
Species Human (GRCh38)
Location 2:4247910-4247932
Sequence CGTGGGCTCTGATCCAATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925478826_925478831 27 Left 925478826 2:4247860-4247882 CCTTTGGAGATAGAGTCTTTAAA No data
Right 925478831 2:4247910-4247932 CGTGGGCTCTGATCCAATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925478831 Original CRISPR CGTGGGCTCTGATCCAATGA GGG Intergenic
No off target data available for this crispr