ID: 925479655

View in Genome Browser
Species Human (GRCh38)
Location 2:4255939-4255961
Sequence GGACCTTTCTCTAGGCTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925479655_925479658 -7 Left 925479655 2:4255939-4255961 CCCTCTAGCCTAGAGAAAGGTCC No data
Right 925479658 2:4255955-4255977 AAGGTCCTGATAGTTTACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925479655 Original CRISPR GGACCTTTCTCTAGGCTAGA GGG (reversed) Intergenic