ID: 925481801

View in Genome Browser
Species Human (GRCh38)
Location 2:4283779-4283801
Sequence TGCCAGGGGCAGGAACTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925481801_925481813 21 Left 925481801 2:4283779-4283801 CCCATCAGTTCCTGCCCCTGGCA No data
Right 925481813 2:4283823-4283845 CCCTTGCATGGCCTCCCTGTTGG No data
925481801_925481810 9 Left 925481801 2:4283779-4283801 CCCATCAGTTCCTGCCCCTGGCA No data
Right 925481810 2:4283811-4283833 TGGTGTCTCCTTCCCTTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925481801 Original CRISPR TGCCAGGGGCAGGAACTGAT GGG (reversed) Intergenic
No off target data available for this crispr