ID: 925483428

View in Genome Browser
Species Human (GRCh38)
Location 2:4302287-4302309
Sequence ACCAGATGGCTTCATTCTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925483423_925483428 15 Left 925483423 2:4302249-4302271 CCTTTAGACTGTGCATACTATGT No data
Right 925483428 2:4302287-4302309 ACCAGATGGCTTCATTCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925483428 Original CRISPR ACCAGATGGCTTCATTCTAA TGG Intergenic