ID: 925486349

View in Genome Browser
Species Human (GRCh38)
Location 2:4336265-4336287
Sequence TGACACCAGCGTGTCTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925486349_925486354 22 Left 925486349 2:4336265-4336287 CCAGGGGAGACACGCTGGTGTCA No data
Right 925486354 2:4336310-4336332 AAGGATGAGCGAGCAGAGTCTGG No data
925486349_925486353 3 Left 925486349 2:4336265-4336287 CCAGGGGAGACACGCTGGTGTCA No data
Right 925486353 2:4336291-4336313 CGGGATGTAGTGAGAATCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925486349 Original CRISPR TGACACCAGCGTGTCTCCCC TGG (reversed) Intergenic
No off target data available for this crispr