ID: 925498669

View in Genome Browser
Species Human (GRCh38)
Location 2:4480659-4480681
Sequence GTTATTGTTCCCACAAGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925498669_925498671 14 Left 925498669 2:4480659-4480681 CCAGATCTTGTGGGAACAATAAC No data
Right 925498671 2:4480696-4480718 AAGGACAGCACCAAGCCATGAGG 0: 49
1: 224
2: 386
3: 389
4: 492
925498669_925498670 -5 Left 925498669 2:4480659-4480681 CCAGATCTTGTGGGAACAATAAC No data
Right 925498670 2:4480677-4480699 ATAACTCACTCACTTTCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925498669 Original CRISPR GTTATTGTTCCCACAAGATC TGG (reversed) Intergenic
No off target data available for this crispr