ID: 925499407

View in Genome Browser
Species Human (GRCh38)
Location 2:4486917-4486939
Sequence GAAAGCTCTTGACTTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925499407_925499410 12 Left 925499407 2:4486917-4486939 CCAGTAACAAGTCAAGAGCTTTC No data
Right 925499410 2:4486952-4486974 AATAATCTGCAGAAAATGGCAGG No data
925499407_925499409 8 Left 925499407 2:4486917-4486939 CCAGTAACAAGTCAAGAGCTTTC No data
Right 925499409 2:4486948-4486970 GGAGAATAATCTGCAGAAAATGG No data
925499407_925499411 13 Left 925499407 2:4486917-4486939 CCAGTAACAAGTCAAGAGCTTTC No data
Right 925499411 2:4486953-4486975 ATAATCTGCAGAAAATGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925499407 Original CRISPR GAAAGCTCTTGACTTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr