ID: 925499410

View in Genome Browser
Species Human (GRCh38)
Location 2:4486952-4486974
Sequence AATAATCTGCAGAAAATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925499405_925499410 22 Left 925499405 2:4486907-4486929 CCAGCGGAGCCCAGTAACAAGTC No data
Right 925499410 2:4486952-4486974 AATAATCTGCAGAAAATGGCAGG No data
925499407_925499410 12 Left 925499407 2:4486917-4486939 CCAGTAACAAGTCAAGAGCTTTC No data
Right 925499410 2:4486952-4486974 AATAATCTGCAGAAAATGGCAGG No data
925499406_925499410 13 Left 925499406 2:4486916-4486938 CCCAGTAACAAGTCAAGAGCTTT No data
Right 925499410 2:4486952-4486974 AATAATCTGCAGAAAATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925499410 Original CRISPR AATAATCTGCAGAAAATGGC AGG Intergenic
No off target data available for this crispr