ID: 925500685

View in Genome Browser
Species Human (GRCh38)
Location 2:4501069-4501091
Sequence AGGCAGAAGACTGGGTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925500685_925500693 10 Left 925500685 2:4501069-4501091 CCACAAAACCCAGTCTTCTGCCT No data
Right 925500693 2:4501102-4501124 TAGAGGCGTGGAACACAAGAGGG No data
925500685_925500689 -7 Left 925500685 2:4501069-4501091 CCACAAAACCCAGTCTTCTGCCT No data
Right 925500689 2:4501085-4501107 TCTGCCTGTAGTGTAGGTAGAGG No data
925500685_925500692 9 Left 925500685 2:4501069-4501091 CCACAAAACCCAGTCTTCTGCCT No data
Right 925500692 2:4501101-4501123 GTAGAGGCGTGGAACACAAGAGG No data
925500685_925500691 -2 Left 925500685 2:4501069-4501091 CCACAAAACCCAGTCTTCTGCCT No data
Right 925500691 2:4501090-4501112 CTGTAGTGTAGGTAGAGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925500685 Original CRISPR AGGCAGAAGACTGGGTTTTG TGG (reversed) Intergenic
No off target data available for this crispr