ID: 925500913

View in Genome Browser
Species Human (GRCh38)
Location 2:4503732-4503754
Sequence CTGTAGTTACAGTTGGTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925500913_925500917 -4 Left 925500913 2:4503732-4503754 CCAAGCACCAACTGTAACTACAG No data
Right 925500917 2:4503751-4503773 ACAGAGTGAGGATAACTGGTAGG No data
925500913_925500918 8 Left 925500913 2:4503732-4503754 CCAAGCACCAACTGTAACTACAG No data
Right 925500918 2:4503763-4503785 TAACTGGTAGGAAATACAGAAGG No data
925500913_925500919 13 Left 925500913 2:4503732-4503754 CCAAGCACCAACTGTAACTACAG No data
Right 925500919 2:4503768-4503790 GGTAGGAAATACAGAAGGTATGG No data
925500913_925500916 -8 Left 925500913 2:4503732-4503754 CCAAGCACCAACTGTAACTACAG No data
Right 925500916 2:4503747-4503769 AACTACAGAGTGAGGATAACTGG No data
925500913_925500920 22 Left 925500913 2:4503732-4503754 CCAAGCACCAACTGTAACTACAG No data
Right 925500920 2:4503777-4503799 TACAGAAGGTATGGCTATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925500913 Original CRISPR CTGTAGTTACAGTTGGTGCT TGG (reversed) Intergenic
No off target data available for this crispr