ID: 925505100 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:4553858-4553880 |
Sequence | GGCTTTGTGTAGAGGGCAGA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
925505100_925505108 | 16 | Left | 925505100 | 2:4553858-4553880 | CCCTCTGCCCTCTACACAAAGCC | No data | ||
Right | 925505108 | 2:4553897-4553919 | TTGATTCATACTAGAGGTGTAGG | No data | ||||
925505100_925505107 | 10 | Left | 925505100 | 2:4553858-4553880 | CCCTCTGCCCTCTACACAAAGCC | No data | ||
Right | 925505107 | 2:4553891-4553913 | CTATTTTTGATTCATACTAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
925505100 | Original CRISPR | GGCTTTGTGTAGAGGGCAGA GGG (reversed) | Intergenic | ||
No off target data available for this crispr |