ID: 925505100

View in Genome Browser
Species Human (GRCh38)
Location 2:4553858-4553880
Sequence GGCTTTGTGTAGAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925505100_925505108 16 Left 925505100 2:4553858-4553880 CCCTCTGCCCTCTACACAAAGCC No data
Right 925505108 2:4553897-4553919 TTGATTCATACTAGAGGTGTAGG No data
925505100_925505107 10 Left 925505100 2:4553858-4553880 CCCTCTGCCCTCTACACAAAGCC No data
Right 925505107 2:4553891-4553913 CTATTTTTGATTCATACTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925505100 Original CRISPR GGCTTTGTGTAGAGGGCAGA GGG (reversed) Intergenic
No off target data available for this crispr