ID: 925506439

View in Genome Browser
Species Human (GRCh38)
Location 2:4569891-4569913
Sequence AGAGAAAACACAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925506439_925506444 30 Left 925506439 2:4569891-4569913 CCCACAATCACTGTGTTTTCTCT No data
Right 925506444 2:4569944-4569966 ACACTGCTGCTGCCAGATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925506439 Original CRISPR AGAGAAAACACAGTGATTGT GGG (reversed) Intergenic
No off target data available for this crispr