ID: 925511752

View in Genome Browser
Species Human (GRCh38)
Location 2:4635000-4635022
Sequence TGAGATCGATGCACTGCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 79}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925511747_925511752 12 Left 925511747 2:4634965-4634987 CCCTCTGCCATTCAACTGATACA 0: 1
1: 0
2: 2
3: 13
4: 149
Right 925511752 2:4635000-4635022 TGAGATCGATGCACTGCTGATGG 0: 1
1: 0
2: 0
3: 3
4: 79
925511748_925511752 11 Left 925511748 2:4634966-4634988 CCTCTGCCATTCAACTGATACAC 0: 1
1: 0
2: 0
3: 6
4: 124
Right 925511752 2:4635000-4635022 TGAGATCGATGCACTGCTGATGG 0: 1
1: 0
2: 0
3: 3
4: 79
925511750_925511752 5 Left 925511750 2:4634972-4634994 CCATTCAACTGATACACCTGGAT 0: 1
1: 0
2: 0
3: 5
4: 84
Right 925511752 2:4635000-4635022 TGAGATCGATGCACTGCTGATGG 0: 1
1: 0
2: 0
3: 3
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925511752 Original CRISPR TGAGATCGATGCACTGCTGA TGG Intergenic