ID: 925511752 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:4635000-4635022 |
Sequence | TGAGATCGATGCACTGCTGA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 83 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 3, 4: 79} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
925511747_925511752 | 12 | Left | 925511747 | 2:4634965-4634987 | CCCTCTGCCATTCAACTGATACA | 0: 1 1: 0 2: 2 3: 13 4: 149 |
||
Right | 925511752 | 2:4635000-4635022 | TGAGATCGATGCACTGCTGATGG | 0: 1 1: 0 2: 0 3: 3 4: 79 |
||||
925511748_925511752 | 11 | Left | 925511748 | 2:4634966-4634988 | CCTCTGCCATTCAACTGATACAC | 0: 1 1: 0 2: 0 3: 6 4: 124 |
||
Right | 925511752 | 2:4635000-4635022 | TGAGATCGATGCACTGCTGATGG | 0: 1 1: 0 2: 0 3: 3 4: 79 |
||||
925511750_925511752 | 5 | Left | 925511750 | 2:4634972-4634994 | CCATTCAACTGATACACCTGGAT | 0: 1 1: 0 2: 0 3: 5 4: 84 |
||
Right | 925511752 | 2:4635000-4635022 | TGAGATCGATGCACTGCTGATGG | 0: 1 1: 0 2: 0 3: 3 4: 79 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
925511752 | Original CRISPR | TGAGATCGATGCACTGCTGA TGG | Intergenic | ||