ID: 925511872

View in Genome Browser
Species Human (GRCh38)
Location 2:4636811-4636833
Sequence GGGAACAACATGAAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925511872_925511880 19 Left 925511872 2:4636811-4636833 CCTCCCTCCTTCATGTTGTTCCC No data
Right 925511880 2:4636853-4636875 ATTTAGTTCAGTAATAATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925511872 Original CRISPR GGGAACAACATGAAGGAGGG AGG (reversed) Intergenic
No off target data available for this crispr