ID: 925511880

View in Genome Browser
Species Human (GRCh38)
Location 2:4636853-4636875
Sequence ATTTAGTTCAGTAATAATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925511874_925511880 15 Left 925511874 2:4636815-4636837 CCTCCTTCATGTTGTTCCCATTT No data
Right 925511880 2:4636853-4636875 ATTTAGTTCAGTAATAATTCAGG No data
925511870_925511880 28 Left 925511870 2:4636802-4636824 CCCACTCAGCCTCCCTCCTTCAT No data
Right 925511880 2:4636853-4636875 ATTTAGTTCAGTAATAATTCAGG No data
925511875_925511880 12 Left 925511875 2:4636818-4636840 CCTTCATGTTGTTCCCATTTCAA No data
Right 925511880 2:4636853-4636875 ATTTAGTTCAGTAATAATTCAGG No data
925511873_925511880 16 Left 925511873 2:4636814-4636836 CCCTCCTTCATGTTGTTCCCATT No data
Right 925511880 2:4636853-4636875 ATTTAGTTCAGTAATAATTCAGG No data
925511871_925511880 27 Left 925511871 2:4636803-4636825 CCACTCAGCCTCCCTCCTTCATG No data
Right 925511880 2:4636853-4636875 ATTTAGTTCAGTAATAATTCAGG No data
925511878_925511880 -2 Left 925511878 2:4636832-4636854 CCATTTCAATGGCCATTCTGCAT No data
Right 925511880 2:4636853-4636875 ATTTAGTTCAGTAATAATTCAGG No data
925511877_925511880 -1 Left 925511877 2:4636831-4636853 CCCATTTCAATGGCCATTCTGCA No data
Right 925511880 2:4636853-4636875 ATTTAGTTCAGTAATAATTCAGG No data
925511869_925511880 29 Left 925511869 2:4636801-4636823 CCCCACTCAGCCTCCCTCCTTCA No data
Right 925511880 2:4636853-4636875 ATTTAGTTCAGTAATAATTCAGG No data
925511872_925511880 19 Left 925511872 2:4636811-4636833 CCTCCCTCCTTCATGTTGTTCCC No data
Right 925511880 2:4636853-4636875 ATTTAGTTCAGTAATAATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925511880 Original CRISPR ATTTAGTTCAGTAATAATTC AGG Intergenic
No off target data available for this crispr