ID: 925517007

View in Genome Browser
Species Human (GRCh38)
Location 2:4693715-4693737
Sequence CTGCTGGTCTTGGGGAATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925516998_925517007 25 Left 925516998 2:4693667-4693689 CCCAGACACATAAATTACTTCAG No data
Right 925517007 2:4693715-4693737 CTGCTGGTCTTGGGGAATTAGGG No data
925516999_925517007 24 Left 925516999 2:4693668-4693690 CCAGACACATAAATTACTTCAGA No data
Right 925517007 2:4693715-4693737 CTGCTGGTCTTGGGGAATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925517007 Original CRISPR CTGCTGGTCTTGGGGAATTA GGG Intergenic
No off target data available for this crispr