ID: 925517543

View in Genome Browser
Species Human (GRCh38)
Location 2:4700268-4700290
Sequence GTGGTGAAGTCTAGCATTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925517543_925517548 18 Left 925517543 2:4700268-4700290 CCACTAATGCTAGACTTCACCAC No data
Right 925517548 2:4700309-4700331 CTTTTGCATTATTTCTGGAGAGG No data
925517543_925517549 19 Left 925517543 2:4700268-4700290 CCACTAATGCTAGACTTCACCAC No data
Right 925517549 2:4700310-4700332 TTTTGCATTATTTCTGGAGAGGG No data
925517543_925517547 13 Left 925517543 2:4700268-4700290 CCACTAATGCTAGACTTCACCAC No data
Right 925517547 2:4700304-4700326 GCTGTCTTTTGCATTATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925517543 Original CRISPR GTGGTGAAGTCTAGCATTAG TGG (reversed) Intergenic
No off target data available for this crispr