ID: 925521511

View in Genome Browser
Species Human (GRCh38)
Location 2:4751327-4751349
Sequence CCTTCTTTCAACTTTTGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925521511_925521515 -8 Left 925521511 2:4751327-4751349 CCAACTCAAAAGTTGAAAGAAGG No data
Right 925521515 2:4751342-4751364 AAAGAAGGAGGCAGTGGTAGAGG No data
925521511_925521517 -2 Left 925521511 2:4751327-4751349 CCAACTCAAAAGTTGAAAGAAGG No data
Right 925521517 2:4751348-4751370 GGAGGCAGTGGTAGAGGTGAGGG No data
925521511_925521518 -1 Left 925521511 2:4751327-4751349 CCAACTCAAAAGTTGAAAGAAGG No data
Right 925521518 2:4751349-4751371 GAGGCAGTGGTAGAGGTGAGGGG No data
925521511_925521516 -3 Left 925521511 2:4751327-4751349 CCAACTCAAAAGTTGAAAGAAGG No data
Right 925521516 2:4751347-4751369 AGGAGGCAGTGGTAGAGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925521511 Original CRISPR CCTTCTTTCAACTTTTGAGT TGG (reversed) Intergenic