ID: 925521517 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:4751348-4751370 |
| Sequence | GGAGGCAGTGGTAGAGGTGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 925521511_925521517 | -2 | Left | 925521511 | 2:4751327-4751349 | CCAACTCAAAAGTTGAAAGAAGG | No data | ||
| Right | 925521517 | 2:4751348-4751370 | GGAGGCAGTGGTAGAGGTGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 925521517 | Original CRISPR | GGAGGCAGTGGTAGAGGTGA GGG | Intergenic | ||