ID: 925521517

View in Genome Browser
Species Human (GRCh38)
Location 2:4751348-4751370
Sequence GGAGGCAGTGGTAGAGGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925521511_925521517 -2 Left 925521511 2:4751327-4751349 CCAACTCAAAAGTTGAAAGAAGG No data
Right 925521517 2:4751348-4751370 GGAGGCAGTGGTAGAGGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925521517 Original CRISPR GGAGGCAGTGGTAGAGGTGA GGG Intergenic