ID: 925526192

View in Genome Browser
Species Human (GRCh38)
Location 2:4805024-4805046
Sequence ATGTAGGCCTAGGATTATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925526192_925526196 -9 Left 925526192 2:4805024-4805046 CCTTTATAATCCTAGGCCTACAT No data
Right 925526196 2:4805038-4805060 GGCCTACATTCCTATGTCAGGGG No data
925526192_925526201 1 Left 925526192 2:4805024-4805046 CCTTTATAATCCTAGGCCTACAT No data
Right 925526201 2:4805048-4805070 CCTATGTCAGGGGGATTTCAGGG No data
925526192_925526197 -8 Left 925526192 2:4805024-4805046 CCTTTATAATCCTAGGCCTACAT No data
Right 925526197 2:4805039-4805061 GCCTACATTCCTATGTCAGGGGG No data
925526192_925526199 0 Left 925526192 2:4805024-4805046 CCTTTATAATCCTAGGCCTACAT No data
Right 925526199 2:4805047-4805069 TCCTATGTCAGGGGGATTTCAGG No data
925526192_925526195 -10 Left 925526192 2:4805024-4805046 CCTTTATAATCCTAGGCCTACAT No data
Right 925526195 2:4805037-4805059 AGGCCTACATTCCTATGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925526192 Original CRISPR ATGTAGGCCTAGGATTATAA AGG (reversed) Intergenic
No off target data available for this crispr