ID: 925530077

View in Genome Browser
Species Human (GRCh38)
Location 2:4849706-4849728
Sequence TGTCAAGGGAATACTGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925530077_925530080 -7 Left 925530077 2:4849706-4849728 CCTGGCACAGTATTCCCTTGACA No data
Right 925530080 2:4849722-4849744 CTTGACATTCACAATTACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925530077 Original CRISPR TGTCAAGGGAATACTGTGCC AGG (reversed) Intergenic
No off target data available for this crispr