ID: 925530499

View in Genome Browser
Species Human (GRCh38)
Location 2:4855558-4855580
Sequence GGAGACAGTGACAGATCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2362
Summary {0: 695, 1: 717, 2: 425, 3: 258, 4: 267}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925530499_925530508 30 Left 925530499 2:4855558-4855580 CCTGATGATCTGTCACTGTCTCC 0: 695
1: 717
2: 425
3: 258
4: 267
Right 925530508 2:4855611-4855633 AGGAAAACAAGCTTAGCTTAGGG No data
925530499_925530506 10 Left 925530499 2:4855558-4855580 CCTGATGATCTGTCACTGTCTCC 0: 695
1: 717
2: 425
3: 258
4: 267
Right 925530506 2:4855591-4855613 AGTTAGAAACATCTAGTTGCAGG No data
925530499_925530507 29 Left 925530499 2:4855558-4855580 CCTGATGATCTGTCACTGTCTCC 0: 695
1: 717
2: 425
3: 258
4: 267
Right 925530507 2:4855610-4855632 CAGGAAAACAAGCTTAGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925530499 Original CRISPR GGAGACAGTGACAGATCATC AGG (reversed) Intergenic
Too many off-targets to display for this crispr