ID: 925530501

View in Genome Browser
Species Human (GRCh38)
Location 2:4855580-4855602
Sequence ATGTTTCTAACTGGGGGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925530501_925530507 7 Left 925530501 2:4855580-4855602 CCATCACCCCCAGTTAGAAACAT No data
Right 925530507 2:4855610-4855632 CAGGAAAACAAGCTTAGCTTAGG No data
925530501_925530509 23 Left 925530501 2:4855580-4855602 CCATCACCCCCAGTTAGAAACAT No data
Right 925530509 2:4855626-4855648 GCTTAGGGCTCCCACTGACTCGG No data
925530501_925530508 8 Left 925530501 2:4855580-4855602 CCATCACCCCCAGTTAGAAACAT No data
Right 925530508 2:4855611-4855633 AGGAAAACAAGCTTAGCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925530501 Original CRISPR ATGTTTCTAACTGGGGGTGA TGG (reversed) Intergenic
No off target data available for this crispr