ID: 925530502 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:4855586-4855608 |
| Sequence | AACTAGATGTTTCTAACTGG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 925530502_925530509 | 17 | Left | 925530502 | 2:4855586-4855608 | CCCCCAGTTAGAAACATCTAGTT | No data | ||
| Right | 925530509 | 2:4855626-4855648 | GCTTAGGGCTCCCACTGACTCGG | No data | ||||
| 925530502_925530508 | 2 | Left | 925530502 | 2:4855586-4855608 | CCCCCAGTTAGAAACATCTAGTT | No data | ||
| Right | 925530508 | 2:4855611-4855633 | AGGAAAACAAGCTTAGCTTAGGG | No data | ||||
| 925530502_925530507 | 1 | Left | 925530502 | 2:4855586-4855608 | CCCCCAGTTAGAAACATCTAGTT | No data | ||
| Right | 925530507 | 2:4855610-4855632 | CAGGAAAACAAGCTTAGCTTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 925530502 | Original CRISPR | AACTAGATGTTTCTAACTGG GGG (reversed) | Intergenic | ||