ID: 925530502 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:4855586-4855608 |
Sequence | AACTAGATGTTTCTAACTGG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
925530502_925530509 | 17 | Left | 925530502 | 2:4855586-4855608 | CCCCCAGTTAGAAACATCTAGTT | No data | ||
Right | 925530509 | 2:4855626-4855648 | GCTTAGGGCTCCCACTGACTCGG | No data | ||||
925530502_925530508 | 2 | Left | 925530502 | 2:4855586-4855608 | CCCCCAGTTAGAAACATCTAGTT | No data | ||
Right | 925530508 | 2:4855611-4855633 | AGGAAAACAAGCTTAGCTTAGGG | No data | ||||
925530502_925530507 | 1 | Left | 925530502 | 2:4855586-4855608 | CCCCCAGTTAGAAACATCTAGTT | No data | ||
Right | 925530507 | 2:4855610-4855632 | CAGGAAAACAAGCTTAGCTTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
925530502 | Original CRISPR | AACTAGATGTTTCTAACTGG GGG (reversed) | Intergenic | ||