ID: 925530503

View in Genome Browser
Species Human (GRCh38)
Location 2:4855587-4855609
Sequence CAACTAGATGTTTCTAACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925530503_925530507 0 Left 925530503 2:4855587-4855609 CCCCAGTTAGAAACATCTAGTTG No data
Right 925530507 2:4855610-4855632 CAGGAAAACAAGCTTAGCTTAGG No data
925530503_925530508 1 Left 925530503 2:4855587-4855609 CCCCAGTTAGAAACATCTAGTTG No data
Right 925530508 2:4855611-4855633 AGGAAAACAAGCTTAGCTTAGGG No data
925530503_925530509 16 Left 925530503 2:4855587-4855609 CCCCAGTTAGAAACATCTAGTTG No data
Right 925530509 2:4855626-4855648 GCTTAGGGCTCCCACTGACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925530503 Original CRISPR CAACTAGATGTTTCTAACTG GGG (reversed) Intergenic