ID: 925530505

View in Genome Browser
Species Human (GRCh38)
Location 2:4855589-4855611
Sequence TGCAACTAGATGTTTCTAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925530505_925530507 -2 Left 925530505 2:4855589-4855611 CCAGTTAGAAACATCTAGTTGCA No data
Right 925530507 2:4855610-4855632 CAGGAAAACAAGCTTAGCTTAGG No data
925530505_925530508 -1 Left 925530505 2:4855589-4855611 CCAGTTAGAAACATCTAGTTGCA No data
Right 925530508 2:4855611-4855633 AGGAAAACAAGCTTAGCTTAGGG No data
925530505_925530509 14 Left 925530505 2:4855589-4855611 CCAGTTAGAAACATCTAGTTGCA No data
Right 925530509 2:4855626-4855648 GCTTAGGGCTCCCACTGACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925530505 Original CRISPR TGCAACTAGATGTTTCTAAC TGG (reversed) Intergenic
No off target data available for this crispr