ID: 925530508

View in Genome Browser
Species Human (GRCh38)
Location 2:4855611-4855633
Sequence AGGAAAACAAGCTTAGCTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925530500_925530508 9 Left 925530500 2:4855579-4855601 CCCATCACCCCCAGTTAGAAACA No data
Right 925530508 2:4855611-4855633 AGGAAAACAAGCTTAGCTTAGGG No data
925530504_925530508 0 Left 925530504 2:4855588-4855610 CCCAGTTAGAAACATCTAGTTGC No data
Right 925530508 2:4855611-4855633 AGGAAAACAAGCTTAGCTTAGGG No data
925530501_925530508 8 Left 925530501 2:4855580-4855602 CCATCACCCCCAGTTAGAAACAT No data
Right 925530508 2:4855611-4855633 AGGAAAACAAGCTTAGCTTAGGG No data
925530502_925530508 2 Left 925530502 2:4855586-4855608 CCCCCAGTTAGAAACATCTAGTT No data
Right 925530508 2:4855611-4855633 AGGAAAACAAGCTTAGCTTAGGG No data
925530499_925530508 30 Left 925530499 2:4855558-4855580 CCTGATGATCTGTCACTGTCTCC 0: 695
1: 717
2: 425
3: 258
4: 267
Right 925530508 2:4855611-4855633 AGGAAAACAAGCTTAGCTTAGGG No data
925530503_925530508 1 Left 925530503 2:4855587-4855609 CCCCAGTTAGAAACATCTAGTTG No data
Right 925530508 2:4855611-4855633 AGGAAAACAAGCTTAGCTTAGGG No data
925530505_925530508 -1 Left 925530505 2:4855589-4855611 CCAGTTAGAAACATCTAGTTGCA No data
Right 925530508 2:4855611-4855633 AGGAAAACAAGCTTAGCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925530508 Original CRISPR AGGAAAACAAGCTTAGCTTA GGG Intergenic
No off target data available for this crispr