ID: 925530509

View in Genome Browser
Species Human (GRCh38)
Location 2:4855626-4855648
Sequence GCTTAGGGCTCCCACTGACT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925530501_925530509 23 Left 925530501 2:4855580-4855602 CCATCACCCCCAGTTAGAAACAT No data
Right 925530509 2:4855626-4855648 GCTTAGGGCTCCCACTGACTCGG No data
925530504_925530509 15 Left 925530504 2:4855588-4855610 CCCAGTTAGAAACATCTAGTTGC No data
Right 925530509 2:4855626-4855648 GCTTAGGGCTCCCACTGACTCGG No data
925530502_925530509 17 Left 925530502 2:4855586-4855608 CCCCCAGTTAGAAACATCTAGTT No data
Right 925530509 2:4855626-4855648 GCTTAGGGCTCCCACTGACTCGG No data
925530500_925530509 24 Left 925530500 2:4855579-4855601 CCCATCACCCCCAGTTAGAAACA No data
Right 925530509 2:4855626-4855648 GCTTAGGGCTCCCACTGACTCGG No data
925530505_925530509 14 Left 925530505 2:4855589-4855611 CCAGTTAGAAACATCTAGTTGCA No data
Right 925530509 2:4855626-4855648 GCTTAGGGCTCCCACTGACTCGG No data
925530503_925530509 16 Left 925530503 2:4855587-4855609 CCCCAGTTAGAAACATCTAGTTG No data
Right 925530509 2:4855626-4855648 GCTTAGGGCTCCCACTGACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925530509 Original CRISPR GCTTAGGGCTCCCACTGACT CGG Intergenic
No off target data available for this crispr