ID: 925530775

View in Genome Browser
Species Human (GRCh38)
Location 2:4859837-4859859
Sequence CAGTTCACACAGATGATAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925530770_925530775 13 Left 925530770 2:4859801-4859823 CCAGATATTATATCCAAGGAAAT No data
Right 925530775 2:4859837-4859859 CAGTTCACACAGATGATAAGTGG No data
925530772_925530775 0 Left 925530772 2:4859814-4859836 CCAAGGAAATAGAGATGAGGACC No data
Right 925530775 2:4859837-4859859 CAGTTCACACAGATGATAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925530775 Original CRISPR CAGTTCACACAGATGATAAG TGG Intergenic
No off target data available for this crispr